circad | circRNAs associated with diseases

Hsa_circ_0016347
Gene	KCNH1	Organism	Human
Genome Locus	chr1:211092981-211192598:-	Build	hg19
Disease	Osteosarcoma	ICD-10	Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41)
DBLink	Link to database	PMID	28424426
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Human osteosarcoma cell lines Saos-2 and MG-63 and the human osteoblast cell line hFOB and Six pairs of tissue samples were collected from patients diagnosed with osteosarcoma who underwent surgery
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACACGTCTTGCCCTCATTATCT Reverse ATAACCTTGGGCTTGTCTTTCA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Jin, H, Jin, X, Zhang, H, Wang, W (2017). Circular RNA hsa-circ-0016347 promotes proliferation, invasion and metastasis of osteosarcoma cells. Oncotarget, 8, 15:25571-25581.